-
Notifications
You must be signed in to change notification settings - Fork 1.1k
Add primerprospector_analyzeprimers #11615
New issue
Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.
By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.
Already on GitHub? Sign in to your account
Open
vagkaratzas
wants to merge
7
commits into
master
Choose a base branch
from
add-primerprospector_analyzeprimers
base: master
Could not load branches
Branch not found: {{ refName }}
Loading
Could not load tags
Nothing to show
Loading
Are you sure you want to change the base?
Some commits from the old base branch may be removed from the timeline,
and old review comments may become outdated.
Open
Changes from all commits
Commits
Show all changes
7 commits
Select commit
Hold shift + click to select a range
0a36992
bots initial attempt
vagkaratzas b031063
removed unnecessary temp output dir, and renamed output files, added …
vagkaratzas 1c38824
flagged the bug in the comment
vagkaratzas 73c3f1f
Merge branch 'master' into add-primerprospector_analyzeprimers
vagkaratzas 6df4059
execfile on PATH for shim, instead of local user/ path
vagkaratzas 0a30c9e
stricter version eval to pass GitHub runners warnings
vagkaratzas 37b1b7b
Merge branch 'master' into add-primerprospector_analyzeprimers
vagkaratzas File filter
Filter by extension
Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
There are no files selected for viewing
7 changes: 7 additions & 0 deletions
7
modules/nf-core/primerprospector/analyzeprimers/environment.yml
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,7 @@ | ||
| --- | ||
| # yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json | ||
| channels: | ||
| - conda-forge | ||
| - bioconda | ||
| dependencies: | ||
| - bioconda::primerprospector=1.0.1 |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,79 @@ | ||
| process PRIMERPROSPECTOR_ANALYZEPRIMERS { | ||
| tag "$meta.id" | ||
| label 'process_single' | ||
|
|
||
| conda "${moduleDir}/environment.yml" | ||
| container "${ workflow.containerEngine in ['singularity', 'apptainer'] && !task.ext.singularity_pull_docker_container ? | ||
| 'https://depot.galaxyproject.org/singularity/primerprospector:1.0.1--py27_0' : | ||
| 'quay.io/biocontainers/primerprospector:1.0.1--py27_0' }" | ||
|
|
||
| input: | ||
| tuple val(meta), path(fasta), path(primers) | ||
|
|
||
| output: | ||
| tuple val(meta), path("${prefix}_hits.txt"), emit: hits | ||
| tuple val(meta), path("${prefix}.ps") , emit: plots | ||
| tuple val("${task.process}"), val('primerprospector'), eval("analyze_primers.py --version 2>&1 | grep -Eo '[0-9]+(\\.[0-9]+)+' | tail -n 1"), topic: versions, emit: versions_primerprospector | ||
|
|
||
| when: | ||
| task.ext.when == null || task.ext.when | ||
|
|
||
| script: | ||
| def args = task.ext.args ?: '' | ||
| prefix = task.ext.prefix ?: "${meta.id}" | ||
| def fasta_arg = fasta instanceof List ? fasta.join(':') : fasta | ||
| def primer_arg = primers ? "-P \"${primers}\"" : '' | ||
| def arg_tokens = args.tokenize() | ||
| if (arg_tokens.any { arg -> arg == '-f' || arg.startsWith('--fasta_seqs') || arg == '-P' || arg.startsWith('--primers_filepath') || arg == '-o' || arg.startsWith('--output_dir') }) { | ||
| error "'-f/--fasta_seqs', '-P/--primers_filepath' and '-o/--output_dir' are reserved by this module. Use input files for fasta/primers and task.ext.prefix to control output file prefixes." | ||
| } | ||
| if (!primers && !(arg_tokens.any { arg -> arg == '-p' || arg.startsWith('--primer_name') } && arg_tokens.any { arg -> arg == '-s' || arg.startsWith('--primer_sequence') })) { | ||
| error "Provide a primers file in the input tuple, or specify a single primer with '-p/--primer_name' and '-s/--primer_sequence' in task.ext.args." | ||
| } | ||
| """ | ||
| # Bug: Primer Prospector 1.0.1 passes numpy floats to range(), which requires integer arguments, while plotting. | ||
| # This shim avoids a Python 2 TypeError that otherwise stops .ps output generation. | ||
| cat <<'PY' > analyze_primers_compat.py | ||
| import __builtin__ | ||
| import os | ||
| import sys | ||
| _range = __builtin__.range | ||
| def _int_range(*args): | ||
| return _range(*[int(arg) for arg in args]) | ||
| __builtin__.range = _int_range | ||
| for path_dir in os.environ.get('PATH', '').split(os.pathsep): | ||
| script_path = os.path.join(path_dir, 'analyze_primers.py') | ||
| if os.path.exists(script_path): | ||
| sys.argv[0] = script_path | ||
| execfile(script_path) | ||
| break | ||
| else: | ||
| raise RuntimeError('Could not find analyze_primers.py on PATH') | ||
| PY | ||
|
|
||
| python analyze_primers_compat.py \\ | ||
| $args \\ | ||
| -f "${fasta_arg}" \\ | ||
| ${primer_arg} | ||
|
|
||
| mv *_hits.txt "${prefix}_hits.txt" | ||
| mv *.ps "${prefix}.ps" | ||
| """ | ||
|
|
||
| stub: | ||
| def args = task.ext.args ?: '' | ||
| prefix = task.ext.prefix ?: "${meta.id}" | ||
| def arg_tokens = args.tokenize() | ||
| if (arg_tokens.any { arg -> arg == '-f' || arg.startsWith('--fasta_seqs') || arg == '-P' || arg.startsWith('--primers_filepath') || arg == '-o' || arg.startsWith('--output_dir') }) { | ||
| error "'-f/--fasta_seqs', '-P/--primers_filepath' and '-o/--output_dir' are reserved by this module. Use input files for fasta/primers and task.ext.prefix to control output file prefixes." | ||
| } | ||
| if (!primers && !(arg_tokens.any { arg -> arg == '-p' || arg.startsWith('--primer_name') } && arg_tokens.any { arg -> arg == '-s' || arg.startsWith('--primer_sequence') })) { | ||
| error "Provide a primers file in the input tuple, or specify a single primer with '-p/--primer_name' and '-s/--primer_sequence' in task.ext.args." | ||
| } | ||
| """ | ||
| echo "$args" | ||
|
|
||
| touch ${prefix}_hits.txt | ||
| touch ${prefix}.ps | ||
| """ | ||
| } | ||
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,89 @@ | ||
| name: "primerprospector_analyzeprimers" | ||
| description: Score PCR primers for binding to target sequences | ||
| keywords: | ||
| - primer design | ||
| - pcr | ||
| - fasta | ||
| - sequence analysis | ||
| - primer scoring | ||
| tools: | ||
| - "primerprospector": | ||
| description: "Primer Prospector is a pipeline of programs to design and analyze PCR primers." | ||
| homepage: "https://pprospector.sourceforge.net/" | ||
| documentation: "https://pprospector.sourceforge.net/scripts/analyze_primers.html" | ||
| tool_dev_url: "https://sourceforge.net/p/pprospector/code/" | ||
| doi: "10.1093/bioinformatics/btr087" | ||
| licence: | ||
| - "GPL" | ||
| args_id: "$args" | ||
| identifier: "" | ||
| input: | ||
| - - meta: | ||
| type: map | ||
| description: | | ||
| Groovy Map containing sample information. Mandatory. | ||
| e.g. `[ id:'sample1' ]` | ||
| - fasta: | ||
| type: file | ||
| description: Target FASTA file or files to score primers against. Mandatory. | ||
| pattern: "*.{fasta,fa,fna}" | ||
| ontologies: | ||
| - edam: "http://edamontology.org/format_1929" # FASTA | ||
| - primers: | ||
| type: file | ||
| description: | | ||
| Tab-delimited primers file containing primer names and sequences. Optional | ||
| when primer name and sequence are supplied with task.ext.args. | ||
| pattern: "*.{txt,tsv}" | ||
| ontologies: | ||
| - edam: "http://edamontology.org/format_3475" # TSV | ||
| output: | ||
| hits: | ||
| - - meta: | ||
| type: map | ||
| description: | | ||
| Groovy Map containing sample information | ||
| e.g. `[ id:'sample1' ]` | ||
| - ${prefix}_hits.txt: | ||
| type: file | ||
| description: Primer hit details, mismatches, gaps, positions, and weighted scores. | ||
| pattern: "*_hits.txt" | ||
| ontologies: | ||
| - edam: "http://edamontology.org/format_3752" # CSV | ||
| plots: | ||
| - - meta: | ||
| type: map | ||
| description: | | ||
| Groovy Map containing sample information | ||
| e.g. `[ id:'sample1' ]` | ||
| - ${prefix}.ps: | ||
| type: file | ||
| description: PostScript summary plots of primer mismatch and weighted score information. | ||
| pattern: "*.ps" | ||
| ontologies: | ||
| - edam: "http://edamontology.org/format_2330" # Textual format | ||
| versions_primerprospector: | ||
| - - ${task.process}: | ||
| type: string | ||
| description: The name of the process | ||
| - primerprospector: | ||
| type: string | ||
| description: The name of the tool | ||
| - analyze_primers.py --version 2>&1 | grep -Eo '[0-9]+(\.[0-9]+)+' | tail -n 1: | ||
| type: eval | ||
| description: The expression to obtain the version of the tool | ||
| topics: | ||
| versions: | ||
| - - ${task.process}: | ||
| type: string | ||
| description: The name of the process | ||
| - primerprospector: | ||
| type: string | ||
| description: The name of the tool | ||
| - analyze_primers.py --version 2>&1 | grep -Eo '[0-9]+(\.[0-9]+)+' | tail -n 1: | ||
| type: eval | ||
| description: The expression to obtain the version of the tool | ||
| authors: | ||
| - "@vagkaratzas" | ||
| maintainers: | ||
| - "@vagkaratzas" |
77 changes: 77 additions & 0 deletions
77
modules/nf-core/primerprospector/analyzeprimers/tests/main.nf.test
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,77 @@ | ||
| nextflow_process { | ||
|
|
||
| name "Test Process PRIMERPROSPECTOR_ANALYZEPRIMERS" | ||
| script "../main.nf" | ||
| process "PRIMERPROSPECTOR_ANALYZEPRIMERS" | ||
|
|
||
| tag "modules" | ||
| tag "modules_nfcore" | ||
| tag "primerprospector" | ||
| tag "primerprospector/analyzeprimers" | ||
|
|
||
| test("synthetic - fasta primers - hits plots") { | ||
|
|
||
| when { | ||
| process { | ||
| """ | ||
| def fasta = channel.of( | ||
| '>seq1', | ||
| 'AAACCCGGGTTTAAACCCGGGTTT', | ||
| '>seq2', | ||
| 'GGGTTTAAACCCGGGTTTAAA' | ||
| ).collectFile(name: 'test.fasta', newLine: true, sort: false) | ||
| def primers = channel.of( | ||
| 'testf\\tAAACCCGGGTTT' | ||
| ).collectFile(name: 'primers.txt', newLine: true, sort: false) | ||
|
|
||
| input[0] = fasta.combine(primers).map { fasta_file, primers_file -> | ||
| [[ id:'test' ], fasta_file, primers_file] | ||
| } | ||
| """ | ||
| } | ||
| } | ||
|
|
||
| then { | ||
| assertAll( | ||
| { assert process.success }, | ||
| { assert snapshot( | ||
| process.out.hits, | ||
| path(process.out.plots[0][1]).exists(), | ||
| process.out.findAll { key, val -> key.startsWith("versions") } | ||
| ).match() } | ||
| ) | ||
| } | ||
| } | ||
|
|
||
| test("synthetic - fasta primers - hits plots - stub") { | ||
|
|
||
| options "-stub" | ||
|
|
||
| when { | ||
| process { | ||
| """ | ||
| def fasta = channel.of( | ||
| '>seq1', | ||
| 'AAACCCGGGTTTAAACCCGGGTTT', | ||
| '>seq2', | ||
| 'GGGTTTAAACCCGGGTTTAAA' | ||
| ).collectFile(name: 'test.fasta', newLine: true, sort: false) | ||
| def primers = channel.of( | ||
| 'testf\\tAAACCCGGGTTT' | ||
| ).collectFile(name: 'primers.txt', newLine: true, sort: false) | ||
|
|
||
| input[0] = fasta.combine(primers).map { fasta_file, primers_file -> | ||
| [[ id:'test' ], fasta_file, primers_file] | ||
| } | ||
| """ | ||
| } | ||
| } | ||
|
|
||
| then { | ||
| assertAll( | ||
| { assert process.success }, | ||
| { assert snapshot(sanitizeOutput(process.out)).match() } | ||
| ) | ||
| } | ||
| } | ||
| } |
63 changes: 63 additions & 0 deletions
63
modules/nf-core/primerprospector/analyzeprimers/tests/main.nf.test.snap
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,63 @@ | ||
| { | ||
| "synthetic - fasta primers - hits plots - stub": { | ||
| "content": [ | ||
| { | ||
| "hits": [ | ||
| [ | ||
| { | ||
| "id": "test" | ||
| }, | ||
| "test_hits.txt:md5,d41d8cd98f00b204e9800998ecf8427e" | ||
| ] | ||
| ], | ||
| "plots": [ | ||
| [ | ||
| { | ||
| "id": "test" | ||
| }, | ||
| "test.ps:md5,d41d8cd98f00b204e9800998ecf8427e" | ||
| ] | ||
| ], | ||
| "versions_primerprospector": [ | ||
| [ | ||
| "PRIMERPROSPECTOR_ANALYZEPRIMERS", | ||
| "primerprospector", | ||
| "1.0.1" | ||
| ] | ||
| ] | ||
| } | ||
| ], | ||
| "timestamp": "2026-05-12T11:08:06.296032028", | ||
| "meta": { | ||
| "nf-test": "0.9.5", | ||
| "nextflow": "26.04.0" | ||
| } | ||
| }, | ||
| "synthetic - fasta primers - hits plots": { | ||
| "content": [ | ||
| [ | ||
| [ | ||
| { | ||
| "id": "test" | ||
| }, | ||
| "test_hits.txt:md5,5ad64787f36ad9ecea34d8bcd912d164" | ||
| ] | ||
| ], | ||
| true, | ||
| { | ||
| "versions_primerprospector": [ | ||
| [ | ||
| "PRIMERPROSPECTOR_ANALYZEPRIMERS", | ||
| "primerprospector", | ||
| "1.0.1" | ||
| ] | ||
| ] | ||
| } | ||
| ], | ||
| "timestamp": "2026-05-12T11:07:58.777832191", | ||
| "meta": { | ||
| "nf-test": "0.9.5", | ||
| "nextflow": "26.04.0" | ||
| } | ||
| } | ||
| } |
Oops, something went wrong.
Add this suggestion to a batch that can be applied as a single commit.
This suggestion is invalid because no changes were made to the code.
Suggestions cannot be applied while the pull request is closed.
Suggestions cannot be applied while viewing a subset of changes.
Only one suggestion per line can be applied in a batch.
Add this suggestion to a batch that can be applied as a single commit.
Applying suggestions on deleted lines is not supported.
You must change the existing code in this line in order to create a valid suggestion.
Outdated suggestions cannot be applied.
This suggestion has been applied or marked resolved.
Suggestions cannot be applied from pending reviews.
Suggestions cannot be applied on multi-line comments.
Suggestions cannot be applied while the pull request is queued to merge.
Suggestion cannot be applied right now. Please check back later.
There was a problem hiding this comment.
Choose a reason for hiding this comment
The reason will be displayed to describe this comment to others. Learn more.
For multiple primers in the input primer file this will cause an error or overwrite some results. Rather all the files should be emitted in the hits output channel. If prefix renaming is desired then it needs to be performed on each of the produced hits files.